primer used for the final pyrosequencing step Search Results


85
Thermo Fisher gene exp lmod1 hs00201704 m1
Gene Exp Lmod1 Hs00201704 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lmod1 hs00201704 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp lmod1 hs00201704 m1 - by Bioz Stars, 2026-04
85/100 stars
  Buy from Supplier

90
Pyrosequencing Inc universal 16s rrna primers
Universal 16s Rrna Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/universal 16s rrna primers/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
universal 16s rrna primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc lpp_snp_f1 biotin-ctggcatctctgcagctcaa
Lpp Snp F1 Biotin Ctggcatctctgcagctcaa, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lpp_snp_f1 biotin-ctggcatctctgcagctcaa/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
lpp_snp_f1 biotin-ctggcatctctgcagctcaa - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc pyrosequencing assay 1033
Pyrosequencing Assay 1033, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pyrosequencing assay 1033/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
pyrosequencing assay 1033 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primer for dhfr codon 108
Primer For Dhfr Codon 108, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer for dhfr codon 108/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primer for dhfr codon 108 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc qmsp taqman probe and primer set
Qmsp Taqman Probe And Primer Set, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qmsp taqman probe and primer set/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
qmsp taqman probe and primer set - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc pyrosequencing primers
Pyrosequencing Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pyrosequencing primers/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
pyrosequencing primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
BIOTAGE qpcr primers
Qpcr Primers, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qpcr primers/product/BIOTAGE
Average 90 stars, based on 1 article reviews
qpcr primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primers for rassf1a
Primers For Rassf1a, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for rassf1a/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primers for rassf1a - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc bisulfite pyrosequencing
Bisulfite Pyrosequencing, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bisulfite pyrosequencing/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
bisulfite pyrosequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primers of 13 genes
Primers Of 13 Genes, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers of 13 genes/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primers of 13 genes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3
Biotinylated Reverse Primer Tcctgtacctggtttgactg Seq Id No. 3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results