85
|
Thermo Fisher
gene exp lmod1 hs00201704 m1 Gene Exp Lmod1 Hs00201704 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp lmod1 hs00201704 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp lmod1 hs00201704 m1 - by Bioz Stars,
2026-04
85/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
universal 16s rrna primers Universal 16s Rrna Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/universal 16s rrna primers/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
universal 16s rrna primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
lpp_snp_f1 biotin-ctggcatctctgcagctcaa Lpp Snp F1 Biotin Ctggcatctctgcagctcaa, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lpp_snp_f1 biotin-ctggcatctctgcagctcaa/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
lpp_snp_f1 biotin-ctggcatctctgcagctcaa - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
pyrosequencing assay 1033 Pyrosequencing Assay 1033, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pyrosequencing assay 1033/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
pyrosequencing assay 1033 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primer for dhfr codon 108 Primer For Dhfr Codon 108, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for dhfr codon 108/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primer for dhfr codon 108 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
qmsp taqman probe and primer set Qmsp Taqman Probe And Primer Set, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qmsp taqman probe and primer set/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
qmsp taqman probe and primer set - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
pyrosequencing primers Pyrosequencing Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pyrosequencing primers/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
pyrosequencing primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
BIOTAGE
qpcr primers Qpcr Primers, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qpcr primers/product/BIOTAGE Average 90 stars, based on 1 article reviews
qpcr primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primers for rassf1a Primers For Rassf1a, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for rassf1a/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primers for rassf1a - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
bisulfite pyrosequencing Bisulfite Pyrosequencing, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bisulfite pyrosequencing/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
bisulfite pyrosequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primers of 13 genes Primers Of 13 Genes, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers of 13 genes/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primers of 13 genes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 Biotinylated Reverse Primer Tcctgtacctggtttgactg Seq Id No. 3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |